Потребителски вход

Запомни ме | Регистрация
24.11.2020 10:44 - COVID 19 - Доказателства за глобална измама
Автор: zahariada Категория: Политика   
Прочетен: 349 Коментари: 1 Гласове:

Постингът е бил сред най-популярни в категория в Blog.bg Постингът е бил сред най-популярни в Blog.bg
  COVID 19 - Доказателства за глобална измама ТЕМИ:Covid 19ПрестъплениеИзмамаПандемияSARS-CoV-2



COVID 19 и последвалите правителствени отговори изглежда са част от международен заговор за извършване на измами. Изглежда няма доказателства, че вирус, наречен SARS-CoV-2, причинява заболяване, наречено COVID 19.

Понякога трябва да отидете с червата си. Не съм експерт по генетика и както винаги ще бъда коригиран. Моето внимание обаче беше привлечено от някои изследвания, публикувани от испанското медицинско списание D-Salud-Discovery. Техният консултативен съвет от висококвалифицирани лекари и учени придава допълнително доверие на техните изследвания. Твърдението им е поразително.

Генетичните праймери и сонди, използвани в RT-PCR тестове за идентифициране на SARS-CoV-2, не са насочени към нищо конкретно. Следвах техниките за търсене, описани в този английски превод на техния доклад, и мога да потвърдя точността на техните твърдения относно нуклеотидните последователности, изброени в протоколите на Световните здравни организации. Можете да направите същото.

D-Salud-Discovery състояние няма тестове, способни да идентифицират SARS-CoV-2. Следователно всички твърдения за предполагаемото въздействие на COVID 19 върху здравето на населението са неоснователни.

Целият официален разказ за COVID 19 е измама. Уж няма научна основа за никоя част от него.

Ако тези твърдения са точни, можем да заявим, че няма доказателства за пандемия, а само илюзия за такава. Ние претърпяхме неизмерима загуба без очевидна причина, освен амбициите на безскрупулни деспоти, които искат да трансформират световната икономика и нашето общество в съответствие с техните цели.

По този начин тази „паразитна класа“ е извършила безброй престъпления. Тези престъпления могат и трябва да бъдат разследвани и преследвани в съда.



Идентификация на какво точно?

Световната здравна организация (СЗО) класифицира COVID-19 (CoronaVIrus Disease 2019). Те обявиха глобална пандемия COVID 19 на 11 март 2020 г.

Лабораторното ръководство за тестване на СЗО гласи:

„Етиологичният агент [причинно-следствена връзка за болестта], отговорен за клъстера от случаи на пневмония във Ухан, е идентифициран като нов бетакоронавирус (в същото семейство като SARS-CoV и MERS-CoV) чрез секвениране от следващо поколение (NGS) от култивирани вирус или директно от проби, получени от няколко пациенти с пневмония. "

Твърдението на СЗО е, че вирусът на SARS-CoV-2 причинява на заболяването COVID-19. Те също така твърдят, че този вирус е ясно идентифициран от изследователи от Ухан.

В новия коронавирус на СЗО за 2019-nCov Ситуационен доклад 1 те посочват:

„Китайските власти идентифицираха нов тип коронавирус, който беше изолиран на 7 януари 2020 г. ... На 12 януари 2020 г. Китай сподели генетичната последователност на новия коронавирус, който страните да използват при разработването на специфични диагностични комплекти.“

Тези две твърдения на СЗО ясно показват, че вирусът SARS-CoV-2 е изолиран (което означава пречистен за изследване) и след това са идентифицирани генетични последователности от изолираната проба. От това бяха разработени диагностични комплекти и разпространени в световен мащаб за тестване на вируса в градовете, градовете и общностите по света. Според СЗО и китайски изследователи тези тестове ще открият вируса, който причинява COVID 19.

И все пак СЗО също заявява:

„Работейки директно от информация за последователността, екипът разработи серия анализи за генетична амплификация (PCR), използвани от лабораториите.“

Учените от Ухан са разработили своите генетични амплификационни анализи от „информация за последователността“, тъй като няма изолирана, пречистена проба от така наречения вирус SARS-CoV-2. Те също така показаха изображения с електронен микроскоп на новооткритите вириони (шипката протеинова топка, съдържаща вирусната РНК.)

Такива протеинови структури обаче не са уникални . Те изглеждат точно като другите кръгли везикули, като ендоцитни везикули и екзозоми.


Вирусолозите твърдят, че не е възможно да се „изолира“ вирус, защото той се репликира само в клетките на гостоприемника. Те добавят, че постулатите на Кох не се прилагат, защото се отнасят до бактериите (които са живи организми). Вместо това, вирусолозите наблюдават цитопатогенните ефекти на вируса (CPE), причиняващи мутация и разграждане на клетките в клетъчните култури.

Когато китайските изследователи за първи път секвенират пълния геном на SARS-CoV-2, те наблюдават CPE в клетките Vero E6 и Huh7. Vero E6 са обезсмъртени маймунски клетъчни линии, а Huh7 са обезсмъртени ракови (туморогенни) клетки. Това означава, че те се поддържат in vitro (в култури на Петри) в продължение на много години.

От основно значение за официалната история на SARS-CoV-2 е идеята, че това е зоонозен вирус, способен да преодолее разликата между видовете от животните до хората. Когато учени от американския CDC „заразиха“ различни клетки с новия вирус, те отбелязаха следното:

„Изследвахме способността на SARS-CoV-2 да инфектира и репликира в няколко често срещани примати и човешки клетъчни линии, включително човешки аденокарциномни клетки (A549) [белодробни клетки], човешки чернодробни клетки (HUH7.0) и човешки ембрионални бъбреци (HEK-293T), в допълнение към Vero E6 и Vero CCL81 [маймунски клетки] ...... Не се наблюдава цитопатичен ефект в никоя от клетъчните линии, с изключение на Vero клетки [маймунски клетки] ....... скромната вирусна репликация и клетките A549 [клетки на човешката белодробна тъкан] са несъвместими с инфекцията на SARS-CoV-2. "

CDC не наблюдава CPE в човешки клетки. Те не видяха доказателства, че този предполагаем вирус е причинил някакво човешко заболяване. Нито този предполагаем човешки вирус показва забележима репликация в човешките клетки, което предполага, че инфекцията от човек на човек би била невъзможна.

Отбелязвайки този проблем, екип от полски учени въведоха този секвениран „вирус“ в клетките на човешкия епител (дихателни пътища) . Те наблюдават ефектите върху тези HAE култури в продължение на 5 дни. Те отбелязват много по-голяма репликация от учените от CDC, но в крайна сметка заявяват:

„Не наблюдавахме никакво освобождаване на вируса от базолатералната страна на HAE културата.“

Това означава, че не са видели никакви доказателства за предполагаемите вириони, нарушаващи мембраната на клетъчната стена. Отново се предполага, че този така наречен вирус не е заразен за хората.

Не е ясно, че SARS-CoV-2 е човешки вирус, способен да причини заболяване. Възможно е дори да не съществува физически. Не е ли нещо повече от концепция, базирана на предсказуеми генетични последователности?


Изследователско пътешествие

Центърът за контрол и профилактика на заболяванията в Ухан и Клиничният център за обществено здраве в Шанхай публикуват първия пълен геном на SARS-CoV-2 (MN908947.1). Това е актуализирано много пъти. Въпреки това, MN908947.1 е първата генетична последователност, описваща предполагаемия етиологичен агент COVID 19 (SARS-CoV-2).

Всички последващи искове, тестове, лечения, статистика, разработване на ваксини и получените политики се основават на тази последователност. Ако тестовете за този нов вирус не идентифицират нищо, което може да причини болести при хората, целият разказ за COVID 19 не е нищо друго освен шарада.

Изследователите от WUHAN заявиха , че ефективно са съчетали генетичната последователност на SARS-CoV-2, като са съпоставили фрагменти, открити в проби, с други, открити преди това, генетични последователности. От събрания материал те откриха 87,1% съвпадение с коронавирус на ТОРС (SARS-Cov). Те използваха de novo сглобяване и насочени PCR и откриха 29 891-базова двойка, която споделя 79,6% съвпадение на последователността с SARS-CoV.

Те трябваше да използват сглобяване de novo, тъй като нямаха априорни познания за правилната последователност или ред на тези фрагменти. Съвсем просто, твърдението на СЗО, че китайските изследователи са изолирали вируса на 7 януари, е невярно.

Екипът на Ухан използва 40 кръга амплификация на RT-qPCR, за да съчетае фрагменти от cDNA (безплатна ДНК, изградена от пробни РНК фрагменти) с публикувания геном на коронавирус на SARS (SARS-CoV). За съжаление не е ясно колко точен е и оригиналният геном на SARS-CoV.

През 2003 г. екип от изследователи от Хонконг изследва 50 пациенти с тежък остър респираторен синдром (ТОРС). Те взеха проби от 2 от тези пациенти и развиха култура в чернодробни клетки на фетална маймуна.

Те създадоха 30 клонинги от генетичния материал, който намериха. Неспособни да намерят доказателства за друг известен вирус, само в една от тези клонирани проби те откриха генетични последователности от „неизвестен произход“.



E Целева последователност на гена


Изследвайки тези неизвестни РНК последователности, те откриха, че 57% съвпадат с говежди коронавирус и миши вируси на хепатит и установяват, че е от семейството Coronaviridae. Разглеждайки тези последователности, за да предполагат новооткрит вирус SARS-CoV (новите открития са амброзия за учените), те са проектирали RT-PCR праймери, за да тестват този нов вирус. Изследователите заявяват:

„Праймерите за откриване на новия вирус са предназначени за RT-PCR откриване на този геном на коронавирус, свързан с човешката пневмония в клинични проби. От 44-те назофарингеални проби, налични от 50-те пациенти с ТОРС, 22 са имали доказателства за свързана с човешка пневмония коронавирусна РНК. "

Половината от тестваните пациенти, които всички имаха едни и същи симптоми, се оказаха положителни за този нов предполагаем вирус. Никой не знае защо другата половина е тествана отрицателно за този нов вирус SARS-CoV. Въпросът не беше зададен.

Този предполагаем вирус е имал само 57% съвпадение на последователността с предполагаемо известния коронавирус. Останалите 43% бяха просто „там“. Секвенираните данни бяха създадени и записани като нов геном като GenBank Accession No. AY274119 .

Впоследствие изследователите от Ухан откриха 79,6% съвпадение на последователността с AY274119 и затова го нарекоха нов щам на SARS-CoV (2019-nCoV - в крайна сметка преименуван на SARS-CoV-2). На никой етап от този процес никой не е произвел изолирана, пречистена проба от който и да е вирус. Всичко, което те имаха, бяха процентни съвпадения на последователност с други процентни съвпадения на последователности.


Изолирайте нищо

Учените са много раздразнени, защото продължават да твърдят, че вирусът е изолиран, но никой не им вярва. Това е така, защото все още никой не е предоставил нито една пречистена проба от вируса SARS-CoV-2. Вместо това имаме завършен геном и, както предстои да открием, не е особено убедителен.

Разследващите журналисти Торстен Енгелбрехт и Константин Деметра помолиха някои от учените, които казаха, че имат изображения на вириони на SARS-C0V-2, да потвърдят, че това са изображения на изолиран, пречистен вирус. Никой от тях не можеше .

В Австралия учени от Института Дохърти обявиха, че са изолирали вируса SARS-CoV-2 . На въпрос за изясняване учените казаха:

„Имаме кратки (РНК) последователности от диагностичния тест, които могат да бъдат използвани в диагностичните тестове“

Това обяснява защо австралийското правителство заявява:

„Надеждността на тестовете за COVID-19 е несигурна поради ограничената база доказателства ... Има ограничени доказателства за оценка на точността и клиничната полезност на наличните тестове за COVID-19.“

През юли в Обединеното кралство група заинтересовани учени написаха писмо до британския премиер Борис Джонсън, в което го помолиха да:

„Изгответе независими рецензирани научни доказателства, доказващи, че вирусът Covid-19 е изолиран.“

Към днешна дата не са получили отговор.

По същия начин британският изследовател Андрю Джонсън отправя искане за свобода на информацията до Англия за обществено здраве (PHE). Той ги помоли да му предоставят своите записи, описващи изолирането на вирус SARS-COV-2. На което те отговориха :

„PHE може да потвърди, че не съдържа информация по начина, предложен от вашата заявка.“

Канадската изследователка Кристин Маси направи подобно искане за свобода на информация, като поиска същото от канадското правителство. На което канадското правителство отговори :

„След като извършихме щателно търсене, със съжаление Ви съобщаваме, че не успяхме да намерим никакви записи, отговарящи на Вашата заявка.“

В САЩ в Центъра за контрол на заболяванията (CDC) RT-PCR Diagnostic Panel се посочва:

„... Понастоящем няма налични количествени вирусни изолати на 2019-nCoV ...... .. Откриването на вирусна РНК може да не показва наличието на инфекциозен вирус или че 2019-nCoV е причинителят на клиничните симптоми.“

Последно актуализиран на 13 юли 2020 г., CDC все още не е получил никаква чиста вирусна проба от всеки пациент, за когото се казва, че има болестта на COVID-19. Те открито признават, че тестовете им не показват непременно дали SARS-CoV-2 присъства или причинява COVID 19.

Казват ни, че нищо от това няма значение. Че сме невежи и просто не разбираме вирусологията. Следователно трябва да изключим снимките на неща, които знаем, че могат да бъдат нещо друго и генетични последователности (които могат да бъдат всичко друго) като убедително доказателство, че този вирус и болестта, която трябва да причини, са реални.



Тестване за нищо

СЗО и всяко правителствено мозъчно тръстче, политически ръководен комитет, държавен научен съветник, наднационални институции и други, които популяризират официалния разказ за COVID 19, твърдят, че SARS-CoV-2 причинява COVID 19. Въпреки че никой никога не е представил проба този предполагаем вирус, предполагаемият геном на SARS-CoV-2 е публикуван . Той е публично достояние.

Твърди се, че ключовите генетични последователности в генома на SARS-CoV-2 имат специфични функции. Това са целевите протеини, за които учените тестват, за да идентифицират присъствието на „вируса“ . Те включват:

  • Ген на РНК-полимераза (Rd-Rp) - Това позволява на РНК на SARS-CoV-2 да се репликира вътре в цитоплазмата на болни епителни клетки от COVID 19.
  • S ген (Orf2) - този гликопротеин образува шип на повърхността на вирион на SARS-CoV-2, което улеснява свързването на SARS-CoV-2 с ACE2 рецепторите на клетките, позволявайки на РНК вътре във вирион протеиновата обвивка (капсида) сега заразената клетка.
  • Е ген (Orf1ab) - малък мембранен протеин, използван при вирусно сглобяване
  • N ген (Orf9a) - нуклеокапсидният ген, който свързва РНК при образуването на капсиди

СЗО поддържа публично достъпен запис на RT-PCR праймерите и сондите, използвани за тестване за SARS-CoV-2. Праймерите са специфични нуклеотидни последователности, които се свързват (отгряват) с антисенсните и сензорните нишки на синтезираната cDNA (наречени съответно праймери и обратни праймери).

СДНК веригите се отделят при нагряване и се охлаждат. Преди охлаждане, нуклеотидни последователности, наречени сонди, се въвеждат в отгряването на специфични целеви области на предполагаемия вирусен геном. По време на усилването, тъй като участъците между праймерите се удължават, когато праймерът удари сонда, сондата се разпада, отделяйки флуоресцентен или багрилен продукт, който след това може да бъде разчетен от изследователите.

Идентификацията на тези маркери, за която учените твърдят, че доказва наличието на SARS-CoV-2 в проба.

Нещо друго, което е публично достъпно, е основният инструмент за търсене на местно подравняване (BLAST). Това позволява на всеки да сравнява публикувани нуклеотидни последователности с всички съхранявани от генетичната база данни на Националния институт по здравеопазване (NIH), наречена GenBank. Следователно можем да взривим заявените SARS-CoV-2 праймери, сонди и целеви генни последователности.


Предните, обратни праймери и сонди на СЗО за предполагаемия вирусен геном на SARS-CoV-2 се основават на RdRp, Orf1, N и E генни профили. Всеки може да ги пусне през BLAST, за да види какво намираме.

Жизненоважната RdRP нуклеотидна последователност, използвана като праймер, е - ATGAGCTTAGTCCTGTTG. Ако пуснем нуклеотиден BLAST, това се записва като пълен изолат на SARS-CoV-2 със 100% съвпадаща идентичност на последователността. По същия начин обратната последователност на праймера на генния E - ATATTGCAGCAGTACGCACACA - разкрива присъствието на последователността Orf1ab, която също идентифицира SARS-CoV-2.

Въпреки това, BLAST също ни позволява да търсим нуклеотидните последователности на микробния и човешкия геном. Ако търсим RdRp SARS-CoV-2 последователност, тя разкрива 99 човешки хромозоми със съвпадение на идентичността на 100% последователност. Orf1ab (Е ген) връща 90 със 100% съвпадение на идентичността на последователността с човешки хромозоми.

Правейки същото за тези последователности с микробно търсене, се откриват 92 микроба със 100% съвпадение с гена SARS-CoV-2 E и 100 съвпадащи микроба със 100% идентичност на последователността с жизненоважния ген на SARS-CoV-2 RdRp.

Винаги, когато проверяваме така наречените уникални генетични маркери за SARS-CoV-2, записани в протоколите на СЗО, ние откриваме пълни или високи проценти на съвпадение с различни фрагменти от човешкия геном. Това предполага, че генетичните последователности, които трябва да идентифицират SARS-CoV-2, не са уникални. Те могат да бъдат всичко - от микробни последователности до фрагменти от човешки хромозоми.

Така наречените проверки на фактите , като проекта за обратна връзка за здравето на Reuters , бързо отхвърлиха твърденията на онези, които са забелязали очевидната липса на специфичност в предполагаемия геном на SARS-CoV-2. Използвайки множество сламени аргументи като „това твърдение предполага, че всеки тест трябва да бъде положителен“ (което не е така) опитът им за развенчаване изпълнява нещо подобно :

Праймерите са предназначени да се свързват със специфични нуклеотидни последователности, които са уникални за вируса. Праймерът може да се свърже с определена хромозома, но обратният праймер не се свързва със същата хромозома и така хромозомата не присъства във вируса SARS-CoV-2. Освен това, тъй като праймерите напред и перверз обгръщат последователността, която трябва да бъде усилена, cDMA последователността между праймери е уникална за вируса.

imageИзглежда, че това умишлено представя невярно значението на тези констатации, като препраща аргумент, който никой, освен самите проверяващи факти, не прави. BLAST търсенията показват, че тези целеви последователности не са уникални за SARS-CoV-2. Нито трябва да се намират всички цели, за да може резултатът да се счита за положителен.

Марокански изследователи разследваха епидемиологията на предполагаеми марокански случаи на ТОРС-CoV-2. Девет процента са положителни за три гена, осемнадесет процента са положителни за два гена и седемдесет и три процента само за един. Както току-що обсъдихме, много от тях може да са положителни за нито един.

Това е изцяло в съответствие с указанията на СЗО за тестване . Те заявяват:

„Оптималната диагноза се състои от NAAT [тест за амплификация на нуклеинова киселина] с най-малко две независими от генома мишени на SARS-CoV-2; обаче в области, където предаването е широко разпространено, може да се използва прост едноцелеви алгоритъм ...... Един или повече отрицателни резултати не изключват непременно инфекцията с SARS-CoV-2. "

Независимо от фалшивите аргументи на добре финансирани проверки на факти, ако праймерите напред и назад идентифицират боклуци, може би единият е фрагмент от хромозома, а другият микробна последователност, тогава усиленият регион между тях вероятно също е боклук.

Аргументът, че RT-PCR намира само РНК, е съзнателен. Естествената транскрипция (разделянето на ДНК веригите) се случва по време на генната експресия. Никой не казва, че цели хромозоми или микроби са секвенирани в предполагаемия геном на SARS-CoV-2. Въпреки че могат, за всичко, което знаем. Те твърдят, че предполагаемите маркери, използвани за тестване на този предполагаем вирус, не са подходящи за целта.


RT-PCR тестовете не правят последователност на целия геном. Те търсят инциденти със специфична флоресценция на сондата, за да покажат наличието на последователности, за които се твърди, че съществуват. Тези последователности са дефинирани от MN908947.1 и следващите актуализации. Тези праймери и сонди не можеха да разкрият нищо друго, освен РНК съвпадения, извлечени от некодиращо, понякога наричано „боклуци“, ДНК (cDNA.)

Например генът SARS-CoV-2 S е предназначен да бъде силно специфичен за генома на вируса SARS-CoV-2. Целевата последователност е - TTGGCAAAATTCAAGACTCACTTTC. Микробното търсене BLAST връща 97 микробни съвпадения със 100% съвпадение на идентичността. Най-ниският процент на съвпадение на самоличността в топ 100 е 95%. Човешки геном BLAST също намира 100% съвпадение на последователността с 86 човешки хромозомни фрагмента.

Без значение къде погледнете в предполагаемия геном на SARS-CoV-2, в тестовите протоколи на СЗО няма нищо, което ясно да идентифицира какво представлява. Целият геном може да е фалшив. Тестовете не доказват съществуването на ТОРС-CoV-2. Всичко, което разкриват, е супа от неуточнен генетичен материал.

Ако е така, тъй като няма изолати или пречистени проби от вируса, без жизнеспособен тест, няма доказателства, че съществува SARS-CoV-2. Следователно, нито има доказателства, че съществува заболяване, наречено COVID 19.

Това предполага, че няма научно основание за каквито и да било твърдения относно номера на случаите на COVID 19, прием в болница или цифри за смъртност. Всички мерки, предприети за борба с този смъртоносен вирус , вероятно не се основават на нищо.


Убедителна измама

Измамата е престъпно деяние. В легалната дефиниция на измама е:

„Някаква измамна практика или умишлено устройство, прибегнато с намерение да лиши друг от правото му или по някакъв начин да му причини нараняване.“

Законовата дефиниция на конспирацията е:

„Комбинация или конфедерация между две или повече лица, образувани с цел да извършат с общи усилия някакво незаконно или престъпно действие“

Изглежда, тези, които твърдят, че сме изправени пред пандемия, не са предоставили никакви доказателства, които да показват, че вирус, наречен SARS-CoV-2, причинява заболяване, наречено COVID 19. Цялата информация, категорично предполагаща тази възможност, е лесно достъпна в публичното пространство. Всеки може да го прочете.

За да има измама, измамата трябва да бъде умишлена. Намерението трябва да бъде умишлено да лиши другите от правата им или да ги нарани по някакъв друг начин. Ако има доказателства за тайно споразумение между лица и / или организации за извършване на измами, това е конспирация (в юрисдикциите на общото право) или Съвместно наказателно предприятие (JCE) съгласно международното право.

Изглежда COVID 19 умишлено е използван като casus belli за водене на война срещу човечеството. Затворени сме в собствените си домове, ограничена свободата ни да се разхождаме, свободата на словото и изразяването е нарушена, правата на протест са ограничени, отделени от близките, бизнесът ни унищожен, психологически бомбардиран, намордван и тероризиран.



Принц Чарлз ни казва да приемем Великата нулираност


Още по-лошото е, че въпреки че няма доказателства за безпрецедентна смъртност от всички причини, имаше необичайни скокове в смъртните случаи. Те корелират точно с мерките за блокиране, при които се оттеглят здравните услуги, за които плащаме, и преориентиране на обществените здравни служби за лечение на едно предполагаемо заболяване с изключение на всички останали.

Освен това се предлага от тези, които предадоха историята на COVID 19, че тази предполагаема болест предоставя оправдание за цялостното преструктуриране на глобалната икономика, нашите политически системи, общества, култури и самото човечество .

За да им бъде позволено да участват в тяхната така наречена „нова норма“, която е трансформация на едро на цялото ни общество без нашето съгласие, те настояват да се подчиним на техните условия.

Те включват, но не се ограничават до биометрично наблюдение на всички, централизиран контрол и наблюдение на всички наши транзакции, потискащи бизнес и социални ограничения и ефективно искане, че нямаме право на суверенитет над собствените ни тела. Това представлява условието за робство .

Няма съмнение, че сме били лишени от правата си и ранени. В юрисдикциите на общото право се предполага невинност, но доказателствата, че умишлено е причинена вреда от международен заговор, са огромни. Деструктивните политики, приети от правителствата по целия свят, очевидно са възникнали сред глобалистическите мозъчни тръстове и наднационални институции много преди появата на тази несъществуваща пандемия.

В юрисдикциите на Наполеоновия кодекс се предполага вина. За да могат обвинените конспиратори да докажат своята невинност, те трябва да покажат, че въпреки неизмеримите си ресурси, те колективно не са могли да получат достъп или да разберат нито едно от свободно достъпните доказателства, предполагащи, че COVID 19 е мит.

Виновните за престъплението конспирация за извършване на глобални измами трябва да бъдат съдени. Ако бъдат признати за виновни, те трябва да бъдат затворени, докато останалите продължаваме да се опитваме да поправим щетите, които вече са нанесли.


Спечели и ти от своя блог!
1. oia - Нищо ново под небето. Отново порция ...
24.11.2020 12:27
Нищо ново под небето. Отново порция лъжи, коварства, измами и т. н.
Отново опити за задаване на мисловен модел в определена насока. Знае се че мисълта е огромна енергия, която твори. Ее, тази енергия насочена и направлявана по невро лингвистичния път---какво ли ще направи ?? Или излиза,
че с нашите камъни, та по нашите глави. Те камъните не са точно наши, но щом ги приемаме, стават наши. Истината е много проста Стоиш здраво на краката, и не позволяваш да ти бъркат в душата. Замисленото няма да им се получи както са го искали, защото кой копае гроб други му---най-напред той влиза там. Хаоса, който умишлено създадоха чрез психозата няма да реализира мечтите на световната камарила. Темата е огромна

За този блог
Автор: zahariada
Категория: Политика
Прочетен: 29451859
Постинги: 17198
Коментари: 19923
Гласове: 26613
«  Януари, 2021