Потребителски вход

Запомни ме | Регистрация
Постинг
18.11.2020 17:04 - COVID19 - доказателства за глобална измама
Автор: zahariada Категория: Политика   
Прочетен: 745 Коментари: 0 Гласове:
2

Последна промяна: 18.11.2020 17:06

Постингът е бил сред най-популярни в категория в Blog.bg Постингът е бил сред най-популярни в Blog.bg
  COVID19 - доказателства за глобална измама Иън Дейвис

https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/?fbclid=IwAR24CJVS87Zvy6aIWsdVSYCTlrRZT8E_X-bwHZPLZgJt7ydxxOjvU3QNDJA

image

COVID 19 и последвалите правителствени отговори изглежда са част от международен заговор за извършване на измами. Изглежда няма доказателства, че вирус, наречен SARS-CoV-2, причинява заболяване, наречено COVID 19.

Понякога трябва да отидете с червата си. Не съм експерт по генетика и както винаги ще бъда коригиран. Моето внимание обаче беше привлечено от някои изследвания, публикувани от испанското медицинско списание D-Salud-Discovery. Техният  консултативен съвет  от висококвалифицирани лекари и учени придава допълнително доверие на техните изследвания. Твърдението им е поразително.

Генетичните праймери и сонди, използвани в RT-PCR тестове за идентифициране на SARS-CoV-2, не са насочени към нищо конкретно. Следвах техниките за търсене, описани в  този английски превод  на техния доклад, и мога да потвърдя точността на техните твърдения относно нуклеотидните последователности, изброени в протоколите на Световните здравни организации. Можете да направите същото.

D-Salud-Discovery състояние няма тестове, способни да идентифицират SARS-CoV-2. Следователно всички твърдения за предполагаемото въздействие на COVID 19 върху здравето на населението са неоснователни.

Целият официален разказ за COVID 19 е измама. Уж няма научна основа за никоя част от него.

Ако тези твърдения са точни, можем да заявим, че няма доказателства за пандемия, а само илюзия за такава. Ние претърпяхме неизмерима загуба без очевидна причина, освен амбициите на безскрупулни деспоти, които искат да трансформират глобалната икономика и нашето общество, за да отговарят на техните цели.

По този начин тази  „паразитна класа“  е извършила безброй престъпления. Тези престъпления могат и трябва да бъдат разследвани и преследвани в съда.

image ИДЕНТИФИКАЦИЯ НА КАКВО ТОЧНО?

Световната здравна организация (СЗО)  класифицира COVID-19  (CoronaVIrus Disease 2019). Те обявиха глобална пандемия COVID 19 на 11 март 2019 г.

image

Лабораторното ръководство за тестване на СЗО   гласи:

Етиологичният агент [причинно-следствена връзка за болестта], отговорен за клъстера на случаите на пневмония във Ухан, е идентифициран като нов бетакоронавирус (в същото семейство като SARS-CoV и MERS-CoV) чрез секвениране от следващо поколение (NGS) от култивиран вирус или директно от проби, получени от няколко пациенти с пневмония. "

Твърдението на СЗО е, че вирусът на SARS-CoV-2  причинява на заболяването COVID-19. Те също така твърдят, че този вирус е ясно идентифициран от изследователи от Ухан.

В новия коронавирус на СЗО за  2019-nCov Ситуационен доклад 1 те посочват:

Китайските власти идентифицираха нов тип коронавирус, който беше изолиран на 7 януари 2020 г. ... На 12 януари 2020 г. Китай сподели генетичната последователност на новия коронавирус за страните, които да използва при разработването на специфични диагностични комплекти. "

Тези две твърдения на СЗО ясно показват, че вирусът SARS-CoV-2 е изолиран (което означава пречистен за изследване) и след това са идентифицирани генетични последователности   от изолираната проба. От това бяха разработени диагностични комплекти и разпространени в световен мащаб за тестване на вируса в градовете и градовете по света. Според СЗО и китайски изследователи тези тестове ще открият вируса, който причинява COVID 19.

И все пак СЗО също заявява:

Работейки директно от информация за последователността, екипът разработи серия анализи за генетична амплификация (PCR), използвани от лабораториите. "

Учените от Ухан разработиха своите анализи за генетична амплификация от  „информация за последователността“,  тъй като нямаше изолирана, пречистена проба от така наречения вирус SARS-CoV-2. Те също така показаха изображения с електронен микроскоп на новооткритите вириони (шипката протеинова топка, съдържаща вирусната РНК.)

Такива протеинови структури обаче не са  уникални . Те изглеждат точно като други кръгли везикули, като ендоцитни везикули и екзозоми.

image

Вирусолозите твърдят, че не е възможно да се  „изолира“  вирус, защото той се репликира само в клетките на гостоприемника. Те добавят, че  постулатите на Кох  не се прилагат, защото се отнасят до бактериите (които са живи организми). Вместо това вирусолозите наблюдават цитопатогенните ефекти на вируса (CPE), причиняващи мутация и деградация на клетките в клетъчните култури.

Когато китайските изследователи за  първи път секвенират  пълния геном на SARS-CoV-2, те наблюдават CPE в клетките Vero E6 и Huh7. Vero E6 са обезсмъртени маймунски клетъчни линии и Huh7 са обезсмъртени ракови (туморогенни) клетки. Това означава, че те се поддържат in vitro (в култури на Петри) в продължение на много години.

От основно значение за официалната история на SARS-CoV-2 е идеята, че това е зоонозен вирус, способен да преодолее разликата между видовете от животните до хората. Когато  учени от американския CDC  „заразиха“  различни клетки с новия вирус, те отбелязаха следното:

Изследвахме способността на SARS-CoV-2 да инфектира и репликира в няколко често срещани примати и човешки клетъчни линии, включително човешки аденокарциномни клетки (A549) [белодробни клетки], човешки чернодробни клетки (HUH7.0) и човешки ембрионални бъбречни клетки ( HEK-293T), в допълнение към Vero E6 и Vero CCL81 [маймунски клетки] ... Не се наблюдава цитопатичен ефект в никоя от клетъчните линии, освен във Vero клетки [маймунски клетки] ... HUH7.0 и 293T клетки показват само умерена вирусна репликация Клетките A549 [клетки на човешката белодробна тъкан] са несъвместими с инфекция с SARS-CoV-2. "

CDC не наблюдава CPE в човешки клетки. Те не видяха доказателства, че този предполагаем вирус е причинил някакво човешко заболяване. Нито този предполагаем човешки вирус показва забележима репликация в човешките клетки, което предполага, че инфекцията от човек на човек би била невъзможна.

Отбелязвайки този проблем, екип от полски учени въведоха този секвениран  „вирус“  в клетките на  човешкия епител (дихателни пътища) . Те наблюдават ефектите върху тези HAE култури в продължение на 5 дни. Те отбелязват много по-голяма репликация от учените от CDC, но в крайна сметка заявяват:

„Не наблюдавахме никакво освобождаване на вируса от базолатералната страна на HAE културата.“

Това означава, че не са видели никакви доказателства за предполагаемите вириони, нарушаващи мембраната на клетъчната стена. Отново предполагаме, че този така наречен вирус не е заразен за хората.

Не е ясно, че SARS-CoV-2 е човешки вирус, способен да причини заболяване. Възможно е дори да не съществува физически. Не е ли нещо повече от концепция, базирана на  предсказуеми  генетични последователности?

image ИЗСЛЕДОВАТЕЛСКО ПЪТЕШЕСТВИЕ

Центърът за контрол и профилактика на заболяванията в Ухан и Клиничният център за обществено здраве в Шанхай публикуват  първия пълен геном на SARS-CoV-2  (MN908947.1). Това е актуализирано много пъти. Въпреки това, MN908947.1 е първата генетична последователност, описваща предполагаемия етиологичен агент COVID 19   (SARS-CoV-2).

Всички последващи искове, тестове, лечения, статистика, разработване на ваксини и получените политики се основават на тази последователност. Ако тестовете за този  нов  вирус не идентифицират нищо, което може да причини заболяване на хората, целият разказ за COVID 19 не е нищо друго освен шарада.

Изследователите от  WUHAN заявиха  , че ефективно са съчетали генетичната последователност на SARS-CoV-2, като са съпоставили фрагменти, открити в проби, с други, открити преди това генетични последователности. От събрания материал те откриха 87,1% съвпадение с коронавирус на ТОРС (SARS-Cov). Те използваха  de novo сглобяване  и насочени PCR и откриха 29 891-базова двойка, която споделя 79,6% съвпадение на последователността с SARS-CoV.

Те трябваше да използват  de novo сглобяване,  тъй като нямаха  априорни  познания за правилната последователност или ред на тези фрагменти. Съвсем просто, твърдението на СЗО, че китайските изследователи са  изолирали  вируса на 7 януари, е невярно.

Екипът на Wuhan използва 40 кръга амплификация на RT-qPCR, за да съчетае фрагменти от cDNA (безплатна ДНК, изградена от пробни РНК фрагменти) с публикувания геном на коронавирус на SARS (SARS-CoV) За съжаление не е ясно колко точен е и оригиналният геном на SARS-CoV.

През 2003 г. екип от  изследователи от Хонконг  изследва 50 пациенти с тежък остър респираторен синдром (ТОРС). Те взеха проби от 2 от тези пациенти и развиха култура в чернодробни клетки на фетална маймуна.

Те са създали 30 клонинги от генетичния материал, който са открили. Неспособни да намерят доказателства за друг известен вирус, само в една от тези клонирани проби те откриха генетични последователности с  „неизвестен произход“.

image

Изследвайки тези неизвестни РНК последователности, те откриха 57% съвпадение с говежди коронавирус и миши вирус на хепатит и установиха, че е от семейството Coronaviridae. Разглеждайки тези последователности, за да предполагат новооткрит вирус SARS-CoV (новите открития са амброзия за учените), те са проектирали RT-PCR праймери, за да тестват за този нов вирус. Изследователите заявяват:

Праймерите за откриване на новия вирус са предназначени за RT-PCR откриване на този геном на коронавирус, свързан с човешката пневмония в клинични проби. От 44-те назофарингеални проби, достъпни от 50 пациенти с ТОРС, 22 са имали доказателства за свързана с човешка пневмония коронавирусна РНК. "

Половината от тестваните пациенти, които всички имаха едни и същи симптоми, се оказаха положителни за този нов предполагаем вирус. Никой не знае защо другата половина е тествана отрицателно за този  нов  вирус SARS-CoV. Въпросът не беше зададен.

Този предполагаем вирус е имал само 57% съвпадение на последователността с предполагаемо известния коронавирус. Останалите 43% бяха просто  „там“.  Секвенираните данни бяха създадени и записани като нов геном като GenBank Accession No.  AY274119 .

Впоследствие изследователите от Ухан откриха 79,6% съвпадение на последователността с AY274119 и поради това го нарекоха нов щам на SARS-CoV (2019-nCoV - в крайна сметка преименуван на SARS-CoV-2). На никой етап от този процес никой не е произвел изолирана, пречистена проба от който и да е вирус. Всичко, което са имали, е процентно съвпадение на последователността с други процентни съвпадения на последователността.

ИЗОЛИРАЙТЕ НИЩО

Учените са много раздразнени, защото продължават да твърдят, че вирусът е изолиран, но никой не им вярва. Това е така, защото все още никой не е предоставил нито една пречистена проба от вируса SARS-CoV-2. Вместо това имаме завършен геном и, както предстои да открием, не е особено убедителен.

Разследващите журналисти Торстен Енгелбрехт и Константин Деметра помолиха някои от учените, които казаха, че имат изображения на вириони на SARS-C0V-2, да потвърдят, че това са изображения на изолиран, пречистен вирус. Никой от тях не можеше .

В Австралия учени от  Института Дохърти обявиха, че са  изолирали  вируса SARS-CoV-2 . На въпрос за изясняване учените казаха:

„Имаме кратки (РНК) последователности от диагностичния тест, които могат да бъдат използвани в диагностичните тестове“

Това обяснява защо  австралийското правителство  заявява:

Надеждността на тестовете за COVID-19 е несигурна поради ограничената база данни ... Налични са ограничени доказателства за оценка на точността и клиничната полезност на наличните тестове за COVID-19. "

През юли в Обединеното кралство група заинтересовани учени  написаха писмо  до британския премиер Борис Джонсън, в което го помолиха да:

Изгответе независими рецензирани научни доказателства, доказващи, че вирусът Covid-19 е изолиран. "

Към днешна дата не са получили отговор.

По същия начин британският изследовател  Андрю Джонсън  отправя искане за свобода на информацията до Англия за обществено здраве (PHE). Той ги помоли да му предоставят своите записи, описващи изолирането на вирус SARS-COV-2. На което  те отговориха :

PHE може да потвърди, че не съдържа информация по начина, предложен от вашата заявка. "

Канадската изследователка Кристин Маси направи подобно искане за свобода на информация, като поиска същото от канадското правителство. На което  канадското правителство отговори :

След като извършихме щателно търсене, със съжаление Ви съобщаваме, че не успяхме да намерим никакви записи, отговарящи на Вашата заявка. “

В САЩ в Центъра за контрол на заболяванията (CDC)  RT-PCR Diagnostic Panel се  посочва:

... Понастоящем няма налични количествени вирусни изолати на 2019-nCoV ...... .. Откриването на вирусна РНК може да не показва наличието на инфекциозен вирус или че 2019-nCoV е причинителят на клиничните симптоми. "

Последно актуализиран на 13 юли 2020 г., CDC все още не е получил никаква чиста вирусна проба от всеки пациент, за когото се казва, че има болестта на COVID-19. Те открито признават, че тестовете им не показват непременно дали SARS-CoV-2 присъства или причинява COVID 19.

Казват ни, че нищо от това няма значение. Че сме невежи и просто не разбираме вирусологията. Следователно трябва да изключим снимките на неща, които знаем, че могат да бъдат нещо друго и генетични последователности (които могат да бъдат всичко друго) като убедително доказателство, че този вирус и болестта, която трябва да причини, са реални.

image ТЕСТВАНЕ ЗА НИЩО

СЗО и всяко правителствено мозъчно тръстче, комитет за управление на политиките, държавен научен съветник, наднационални институции и други, които популяризират официалния разказ за COVID 19, твърдят, че SARS-CoV-2 причинява COVID 19.

Въпреки че никой никога не е създал проба от този предполагаем вирус, предполагаемият геном на SARS-CoV-2  е публикуван . Той е публично достояние.

Твърди се, че ключовите  генетични последователности в генома на SARS-CoV-2 имат специфични функции. Това са целевите протеини, за които учените тестват, за да  идентифицират  присъствието на  „вируса“ . Те включват:

  • Ген на РНК-полимераза (Rd-Rp) - Това позволява на РНК на SARS-CoV-2 да се репликира вътре в цитоплазмата на болните епителни клетки COVID 19.
  • S ген (Orf2) - този гликопротеин образува шипа на повърхността на вирион на SARS-CoV-2, което улеснява свързването на SARS-CoV-2 с ACE2 рецепторите на клетките, позволявайки на РНК вътре във вирион протеиновата обвивка (капсид) да премине в сега  заразената  клетка.
  • Е ген (Orf1ab) - малък мембранен протеин, използван при вирусно сглобяване
  • N ген (Orf9a) - нуклеокапсидният ген, който свързва РНК при образуването на капсиди

СЗО поддържа  публично достъпен запис  на RT-PCR праймерите и сондите, използвани за тестване за SARS-CoV-2. Праймерите са специфични нуклеотидни последователности, които се свързват (отгряват) с антисенсните и сензорните нишки на синтезираната cDNA (наречени съответно праймери и обратни праймери).

СДНК веригите се отделят при нагряване и се реформират при охлаждане. Преди охлаждане, нуклеотидни последователности, наречени сонди, се въвеждат в отгряването към специфични целеви области на предполагаемия вирусен геном. По време на усилването, тъй като участъците между праймерите се удължават, когато праймерът удари сонда, сондата се разпада, отделяйки флуоресцентен или багрилен продукт, който след това може да бъде разчетен от изследователите.

Идентификацията на тези маркери, за която учените твърдят, че доказва наличието на SARS-CoV-2 в проба.

Нещо друго, което е публично достъпно, е  основният инструмент за търсене на местно подравняване  (BLAST). Това позволява на всеки да сравнява публикувани нуклеотидни последователности с всички съхранявани от генетичната база данни на Националния институт по здравеопазване (NIH), наречена GenBank. Следователно можем да взривим заявените SARS-CoV-2 праймери, сонди и целеви генни последователности.

Предните, обратни праймери и сонди на СЗО за предполагаемия вирусен геном на SARS-CoV-2 се основават на RdRp, Orf1, N и E генни профили. Всеки може да ги пусне през BLAST, за да види какво намираме.

Жизненоважната RdRP нуклеотидна последователност, използвана като праймер, е - ATGAGCTTAGTCCTGTTG. Ако пуснем нуклеотиден BLAST, това се записва като пълен изолат на  SARS-CoV-2  със 100% съвпадаща идентичност на последователността. По същия начин обратната последователност на праймера на гена E - ATATTGCAGCAGTACGCACACA - разкрива присъствието на последователността Orf1ab, която също  идентифицира  SARS-CoV-2.

Въпреки това, BLAST също ни позволява да търсим нуклеотидните последователности на микробния и човешкия геном. Ако търсим RdRp SARS-CoV-2 последователност, тя разкрива 99 човешки хромозоми със съвпадение на идентичността на 100% последователност. Orf1ab (Е ген) връща 90 със 100% съвпадение на идентичността на последователността с човешки хромозоми.

Правейки същото за тези последователности с микробно търсене, се откриват 92 микроба със 100% съвпадение с гена SARS-CoV-2 E и 100 съвпадащи микроба със 100% идентичност на последователността с жизненоважния ген на SARS-CoV-2 RdRp.

Винаги, когато проверяваме така наречените уникални генетични маркери за SARS-CoV-2, записани в протоколите на СЗО, откриваме пълни или високи проценти на съвпадение с различни фрагменти от човешкия геном. Това предполага, че генетичните последователности, които трябва да идентифицират SARS-CoV-2, не са уникални. Те могат да бъдат всичко - от микробни последователности до фрагменти от човешки хромозоми.

Така наречените  проверки на фактите , като  проекта за обратна връзка за здравето на Reuters  , бързо отхвърлиха твърденията на  онези, които са забелязали  очевидната липса на специфичност в предполагаемия геном на SARS-CoV-2.

Използвайки множество сламени аргументи от рода на  „това твърдение предполага, че всеки тест трябва да бъде положителен“  (което не е така)  опитът  им за  развенчаване изпълнява нещо подобно :

Праймерите са предназначени да се свързват със специфични нуклеотидни последователности, които са уникални за вируса. Праймерът може да се свърже с определена хромозома, но обратният праймер не се свързва със същата хромозома и така хромозомата не присъства във вируса SARS-CoV-2. Освен това, тъй като праймерите напред и перверз обгръщат последователността, която трябва да бъде усилена, cDMA последователността между праймери е уникална за вируса.

Изглежда, че това умишлено представя невярно значението на тези констатации, като препраща аргумент, който никой, освен самите проверяващи факти, не прави. BLAST търсенията показват, че тези целеви последователности не са уникални за SARS-CoV-2. Нито трябва да се намират всички цели, за да може резултатът да се счита за положителен.

Марокански изследователи  разследваха епидемиологията  на предполагаеми марокански  случаи  на ТОРС-CoV-2. Девет процента са положителни за три гена, осемнадесет процента са положителни за два гена и седемдесет и три процента само за един. Както току-що обсъдихме, много от тях може да са положителни за нито един.

Това е изцяло в съответствие с  указанията на СЗО за тестване . Те заявяват:

„Оптималната диагноза се състои от NAAT [тест за амплификация на нуклеинова киселина] с най-малко две независими от генома мишени на SARS-CoV-2; обаче в области, където предаването е широко разпространено, може да се използва прост едноцелеви алгоритъм ...... Един или повече отрицателни резултати не изключват непременно инфекцията с SARS-CoV-2. "

Независимо от фалшивите аргументи на добре финансирани  проверки на факти,  ако праймерите напред и назад идентифицират боклуци, може би единият е фрагмент от хромозома, а другият микробна последователност, тогава усиленият регион между тях вероятно също е боклук.

Аргументът, че RT-PCR намира само РНК, е съзнателен. Естествената транскрипция (разделянето на ДНК веригите) се случва по време на генната експресия. Никой не казва, че цели хромозоми или микроби са секвенирани в предполагаемия геном на SARS-CoV-2. Въпреки че могат, за всичко, което знаем. Те твърдят, че предполагаемите маркери, използвани за тестване на този предполагаем вирус, не са подходящи за целта.

image

RT-PCR тестовете не правят последователност на целия геном. Те търсят инциденти със специфична флоресценция на сондата, за да покажат наличието на последователности, за които се твърди, че съществуват. Тези последователности са дефинирани от MN908947.1 и следващите актуализации. Тези праймери и сонди не биха могли да разкрият нищо друго освен РНК съвпадения, извлечени от некодиращо, понякога наричано  „боклуци“,  ДНК (cDNA.)

Например  генът SARS-CoV-2 S  е предназначен да бъде силно специфичен за генома на вируса SARS-CoV-2. Целевата последователност е - TTGGCAAAATTCAAGACTCACTTTC. Микробното търсене BLAST връща 97 микробни съвпадения със 100% съвпадение на последователността на идентичността. Най-ниският процент на съвпадение на самоличността в топ 100 е 95%. Човешки геном BLAST също намира 100% съвпадение на последователността с 86 човешки хромозомни фрагмента.

Независимо къде погледнете в предполагаемия геном на SARS-CoV-2, в тестовите протоколи на СЗО няма нищо, което ясно да идентифицира какво представлява. Целият геном може да е фалшив. Тестовете не доказват съществуването на SARS-CoV-2. Всичко, което разкриват, е супа от неуточнен генетичен материал.

Ако е така, тъй като няма изолати или пречистени проби от вируса, без жизнеспособен тест, няма доказателства, че съществува SARS-CoV-2. Следователно, нито има доказателства, че съществува заболяване, наречено COVID 19.

Това предполага, че няма научно основание за каквито и да било твърдения относно номера на случаите на COVID 19, прием в болница или данни за смъртност. Всички мерки, предприети за  борба с  този  смъртоносен вирус  , вероятно не се основават на нищо.

УБЕДИТЕЛНА ИЗМАМА

Измамата е престъпно деяние. В  легалната дефиниция  на измама е:

„Някаква измамна практика или умишлено устройство, прибегнали с намерение да лишат друг от правото му или по някакъв начин да му причинят нараняване.“

Законовата дефиниция на конспирацията е:

„Комбинация или конфедерация между две или повече лица, образувани с цел да извършат чрез съвместни усилия някакво незаконно или престъпно действие“

Изглежда, тези, които твърдят, че сме изправени пред пандемия, не са предоставили никакви доказателства, които да показват, че вирус, наречен SARS-CoV-2, причинява заболяване, наречено COVID 19. Цялата информация, категорично предполагаща тази възможност, е лесно достъпна в публичното пространство. Всеки може да го прочете.

За да има измама, измамата трябва да бъде умишлена. Намерението трябва да бъде умишлено да лиши другите от правата им или да ги нарани по някакъв друг начин. Ако има доказателства за тайно споразумение между лица и / или организации за извършване на измами, това е конспирация (в юрисдикциите на общото право) или  Съвместно наказателно предприятие  (JCE) съгласно международното право.

Изглежда COVID 19 умишлено е използван като  casus belli  за водене на война срещу човечеството. Затворени сме в собствените си домове, ограничена свободата ни да се разхождаме, свободата на словото и изразяването е нарушена, правата на протест са ограничени, отделени от близките, бизнесът ни унищожен, психологически бомбардиран, намордван и тероризиран.

Още по-лошото е, че въпреки че  няма доказателства  за безпрецедентна  смъртност от  всички причини, имаше необичайни скокове в смъртните случаи. Те  корелират точно с мерките за блокиране, при  които се оттеглят здравните услуги, за които плащаме, и преориентиране на обществените здравни служби за лечение на едно предполагаемо заболяване с изключение на всички останали.

Освен това се предлага от тези, които са препратили историята на COVID 19, че тази предполагаема болест предоставя оправдание за цялостното преструктуриране на глобалната икономика, нашите политически системи, общества, култури и  самото човечество .

За да им бъде  позволено  да участват в тяхната така наречена  „нова норма“,  която е трансформация на едро на цялото ни общество без нашето съгласие, те настояват да се подчиним на техните условия.

Те включват, но не се ограничават до биометрично наблюдение на всички, централизиран контрол и мониторинг на всички наши транзакции, потискащи бизнес и социални ограничения и ефективно искане, че нямаме право на суверенитет над собствените ни тела. Това представлява  условието за робство .

Няма съмнение, че сме били лишени от правата си и ранени. В юрисдикциите на общото право се предполага невинност, но доказателствата, че умишлено е причинена вреда от международен заговор, са огромни. Деструктивните политики, приети от правителствата по целия свят, очевидно са възникнали сред глобалистическите мозъчни тръстове и наднационални институции много преди появата на тази несъществуваща пандемия.

В юрисдикциите на Наполеоновия кодекс се предполага вина. За да могат обвинените конспиратори да докажат своята невинност, те трябва да покажат, че въпреки неизмеримите си ресурси, те колективно не са могли да получат достъп или да разберат нито едно от свободно достъпните доказателства, предполагащи, че COVID 19 е мит.

Виновните за престъплението конспирация за извършване на глобални измами трябва да бъдат съдени. Ако бъдат признати за виновни, те трябва да бъдат затворени, докато ние останалите продължаваме да се опитваме да поправим щетите, които вече са нанесли.




Гласувай:
2



Спечели и ти от своя блог!
Няма коментари
Търсене

За този блог
Автор: zahariada
Категория: Политика
Прочетен: 35892563
Постинги: 21676
Коментари: 21540
Гласове: 30185
Архив
Календар
«  Януари, 2023  
ПВСЧПСН
1
2345678
9101112131415
16171819202122
23242526272829
3031