Потребителски вход

Запомни ме | Регистрация
Постинг
19.12.2020 12:10 - Измамата е потвърдена: PCR не открива SARS-CoV-2
Автор: zahariada Категория: Други   
Прочетен: 360 Коментари: 6 Гласове:
3


Постингът е бил сред най-популярни в категория в Blog.bg Постингът е бил сред най-популярни в Blog.bg
 
image
Измамата е потвърдена: PCR не открива SARS-CoV-2  16 декември 2020 г. ренегат  От GMI Reporter

Неофициален английски превод на „Измами и фалши в медицинската област“, ​​първоначално публикуван на  www.dsalud.com

Генетичните последователности, използвани в PCR за откриване на съмнения за SARS-CoV-2 и за диагностициране на случаи на заболяване и смърт, приписвани на Covid-19 , присъстват в десетки последователности на самия човешки геном и в тези на около стотина микроба. И това включва инициаторите или праймерите, най-обширните фрагменти, взети на случаен принцип от предполагаемия им „геном“ и дори така наречените „целеви гени“, за които се твърди, че са специфични за „новия коронавирус“. Тестът е безполезен и всички получени до момента „положителни“ резултати трябва да бъдат обезсилени по научен път и съобщени на засегнатите; а ако са починали - на техните близки. Стивън Бъстин, един от водещите световни експерти по PCR, всъщност казва, че при определени условия всеки може да даде положителен тест!

Предупреждаваме ви от март: не можете да провеждате конкретни тестове за вирус, без да знаете компонентите на вируса, които се опитвате да откриете. И компонентите не могат да бъдат известни, без предварително да са изолирали / пречистили този вирус. Оттогава продължаваме да натрупваме доказателства, че никой не е изолирал SARS-CoV-2 и по-важното е, че той никога не може да бъде изолиран поради причините, които обяснихме миналия месец (прочетете доклада „ Можете ли да докажете, че има патогенни вируси? “ на нашия уебсайт - www.dsalud.com -). И в настоящия доклад ще предложим нови данни, които показват, че RT-PCR не открива така наречената SARS-CoV-2, както е известна, а фрагменти от човешка РНК и тези на множество микроби.

Вече обяснихме многобройните проблеми, които RT-PCR поставя, признати от организации или правителства като СЗО или CDC и от престижни международни експерти като д-р Стивън Бюстин, който разглежда както произвола на установяване на критерии за резултати, така и избора на броят на циклите да бъде глупост, тъй като те могат да доведат до това, че всеки има положителни резултати.

В този доклад ще добавим резултатите от конкретно изследване, което сме направили от данните, публикувани за предполагаемия SARS-CoV-2 и за протоколите, одобрени от СЗО за използването на RT-PCR, както и данните, съответстващи на към останалата част от „човешките коронавируси“. И заключенията са изключително сериозни: нито един от седемте „човешки коронавируса“ всъщност не е изолиран и всички последователности на праймерите на съответните им PCR, както и тези на голям брой фрагменти от предполагаемите им геноми се намират в различни области на човешкия геном и в геномите на бактерии и археи, като тези: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus свински, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella Bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter Ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis и дълъг списък с други.

Ще обясним стъпка по стъпка изследването, което ни е довело до такова необичайно заключение.

ИЗОЛИРАНИ ЛИ НИКОЙ ЧОВЕШКИ КОРОНАВИРУСИ

През първата половина на април, когато първото изследване, което проведохме, показа, че SARS-CoV-2 не е изолиран и тъй като тези, които твърдят, че са го правили, разчитат на „изолати“ на предишни „човешки коронавируси“, ние започнахме да правим задълбочен преглед на заявените изолати. По-конкретно, прегледахме предполагаемата работа по изолиране на предполагаеми човешки коронавируси 229E (за които се твърди, че са били изолирани през 1965 г.), OC43 (през 1967 г.), SARS-CoV (през 2003 г.), NL63 (през 2004 г.), HKU1 (през 2005 г.) и MERSCoV (през 2012 г). И това са резултатите:

Коронавирус 229Е.

Справочна статия : Дороти Хамре и Джон Прокнау . Нов вирус, изолиран от дихателните пътища на човека  . Известия на Обществото за експериментална биология и медицина, 121: 1: 190-193. 1 януари 1966 г.

Тъй като авторите се позовават на други статии, за да обяснят метода на изолация - който те наричат Допълнителна фиксация - ние се консултирахме със справочна статия за този метод: тази на Janet W. Hartley et al. Анализ на фиксиране на комплемента и тъканна култура за вируси на мишка левкемия PNAS, 53 (5): 931-938, май 1965 г. Това е процедура, която вече не е използвана и използва реакцията антиген-антитяло, за да открие едното или другото. В случая, с който се занимаваме, целта беше да се открият антигените на предполагаемия нов вирус, но, както вече обяснихме, са необходими специфични антитела, които не могат да бъдат получени при първото откриване на вирус.

Коронавирус OC43.

Справочна статия : Пол Лий . Молекулярна епидемиология на човешки коронавирус OC43 в Хонг Конг. Дисертация за катедрата по микробиология, Университет в Хонг Конг, август 2007 г. Центърът на HKU Scholars Hub.

Това, което се смяташе за вирусна РНК, беше извлечено от култури без никакво доказателство, че РНК принадлежи към вирус. Използваният инструмент - комплект QIAamp - премахва реагентите, инхибиторите и замърсителите, но това, което не може да направи, е да определи откъде идва извлечената РНК. И няма контрол. След това се усилва чрез PCR и се секвенира, като се приема (!), Че това е генетична информация на вирус. И накрая, авторът разсъждава за мутации, рекомбинации, генотипове, молекулярна еволюция, щамове и друг жаргон, който предава идеята - недоказано - че се работи с „вирус“.

SARS-CoV коронавирус.

Справочна статия: JSM Peiris и други . Коронавирусът като възможна причина за ТОРС . Lancet 361: 1319-25, април 2003 г.

В статията не се споменава за пречистване . Дори не се споменава за филтриране или центрофугиране. Посочва се само, че „вирусите са били изолирани в клетки на черния дроб на фетална маймуна от назофарингеални аспирати и белодробни биопсии на двама пациенти“ . Няма контроли . Единственото споменаване е за „цитопатичен ефект“, който се приписва на вирус и че PCR е направен за известни вируси и ретровируси без да се получат резултати. И накрая, RT-PCR беше направен с „случайни инициатори“ и се открива последователност „с неизвестен произход“, при която се установява „слаба хомология със семейството коронавиридии“ . След това те проектираха праймери за тази последователност и при тестване на 44 проби от ТОРС само 22 пациенти са положителни.

Коронавирус NL63.

Справочна статия: Лиа ван дер Хок и други . Идентифициране на нов човешки коронавирус. Nature Medicine, 10, 4 април 2004 г.

Авторите заявяват, че „идентифицирането на неизвестни патогени с помощта на инструменти за молекулярна биология е трудно, тъй като целевата последователност не е известна, така че специфичните за PCR инициатори не могат да бъдат проектирани“.

Това, което са използвали, е инструмент, който те сами са разработили, наречен VIDISCA, който според тях не изисква предварително познаване на последователността! Това възможно ли е? Нека да видим как работи: първо се подготвя културата и се предполага, че има вирус поради доказателствата за „цитопатичен ефект“. Новостта, въведена от този метод, е, че се добавят „рестрикционни ензими“, ензими, които режат молекулите на нуклеиновата киселина на определени места и винаги с еднаква дължина. По този начин, ако след действието на тези ензими те наблюдават много фрагменти от ДНК или РНК, които са еднакви или много сходни, те заключават, че произхожда от вирус, тъй като геномът на гостоприемника ще представи произволни съкращения, докато генома на вируса представя голям брой копия, които са еднакви поради репликацията на вируса. И правилно ли е такова приспадане? Разбира се, че не! Това предположение (което допълва предишното предположение, че има вирус) не взема предвид, че има „вирусоподобни частици“, „ретровирусоподобни частици“, „ендогенни ретровируси“, „екзозоми“, „извънклетъчни“ частици и дори митохондриална ДНК. В отричането има множество частици, които притежават същите репродуктивни характеристики в големи количества като „вируси“ иследователно може да фалшифицира резултатите, като произвежда голям брой идентични копия, когато се реже от ензими, както е признато в статия за техниката VIDISCA, озаглавена Enhanced bioinformatic proSling на библиотеките VIDISCA за откриване и откриване на вируси. Той е публикуван в том 263 на Virus Research на 2 април 2019 г. и неговите автори - Cormac M. Kinsella et al . - признават, че „не се очаква излишък във вложката VIDISCA от нуклеиновата киселина на фона на гостоприемника, освен в случая“ вирусоподобни характеристики , т.е. висок брой копия, както в митохондриалната ДНК.

Коронавирус HKU1.

Справочна статия: Patrick CY Woo и други . Характеризиране и пълна геномна последователност на нов коронавирус, коронавирус HKU1, от пациенти с пневмония. Journal of Virology, 79, 2, януари 2005 г.

Статията невероятно започва с тези думи: „Въпреки обширни изследвания при пациенти с инфекции на дихателните пътища, не е установена микробиологична причина при значителна  част от пациентите . РНК се извлича от непречистени култури. " И се използва PCR с гени на коронавирус. За последователността те използват две бази данни за протеини, организирани в семейства, домейни и функционални сайтове -PFAM и INterProScan- комбинирани с две компютърни програми, които извършват „прогнози“ за това как трябва да се комбинират нуклеотидите. Текстът добавя: „ Поредиците бяха ръчно сглобени и редактирани, за да се получи окончателна последователност на вирусния геном“ . И отново няма контрол.

MERS-CoV коронавирус.

Справочна статия : Ali Moh Zaki и други . Изолация на нов коронавирус от човек с пневмония в Саудитска Арабия. The New England Journal of Medicine, 367: 19, ноември 2012 г.

Генетичният материал се извлича директно от супернатантата на културата и пробата от храчки с инструмент, наречен High Purй Virus Nucleic Acid Kit и след това се тества с различни PCR за различни известни микроорганизми. Не се споменава пречистване и няма контрол.

Накратко, това , което беше направено с първите коронавируси - и с много други предполагаеми вируси - е да се култивират предполагаемо заразени тъкани - всеки „цитопатичен ефект“ се дължи на наличието само на вирус - и тогава се получават или някои протеини, които без всеки тест се счита за „вирусен антиген“ и когато тези „антигени“ бъдат открити в култури, той се тълкува като „изолиране“ или се извличат фрагменти от нуклеинови киселини, като се приема, че принадлежат на вирус.

Вече обяснихме в статията, публикувана в предишния брой на списанието, че според д-р Стефан Ланка така нареченият „цитопатичен ефект“ всъщност е ефект, причинен от условията на самата култура. Това се признава например в статията , предизвикана от антибиотици, освобождаване на малки извънклетъчни везикули (екзозоми) с повърхностно свързана ДНК, публикувана на 15 август 2017 г. на уебсайта на Nature и подписана от Andrea Nйmeth и други

Https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf Това обяснява, че някои вещества -такава като antibiotics- добавен в ин витро експерименти може да се подчертае, клетъчните култури, така че да генерира нови последователности, които не са били открити по-рано. Това вече беше забелязано от никой друг освен д-р Барбара МакКлинток през 1983 г. по време на нейната лекция за Нобелова награда, както може да се види на https://www.nobelprize.org/uploads/2018/06 / mcclintock- лекция.pdf

По същество НИКОЙ ОТ СЕДЕМ ПРЕДЛОЖЕНИТЕ ЧОВЕШКИ КОРОНАВИРУС НАИСТИНА НЕ Е ИЗОЛИРАН . Единственото нещо, което се различава между тях, са лабораторните процедури и техники, които постепенно стават все по-усъвършенствани, което в случая предполага не по-голяма точност, а по-голяма способност за измама и самоизмама, която е завършила с виртуалното производство на ТОРС-CoV-2.

И очевидната последица от липсата на доказателства за неговата изолация е, че такива „коронавируси“ не могат да бъдат държани отговорни за каквото и да е заболяване. Освен това всички тестове - от какъвто и да е вид - на базата на предполагаемите компоненти на тези „вируси“ (нуклеинови киселини или протеини) са напълно дисквалифицирани като „тестове за инфекция“ и още повече като „диагностика“ на заболявания.

ОЩЕ НЕОТГОВОРНИ ИСКАНИЯ

В предишния брой вече събрахме отговорите, дадени от авторите на няколко статии, които предполагаемо описват изолирането на SARS-CoV-2, в които те признават, че не са се „пречистили“, което по подразбиране означава признаване, че вирусът не е изолиран. И сега ще добавим още едно доказателство: отговорите, дадени от различни власти - политически и здравни - от различни страни относно пречистването и изолирането на ТОРС-CoV-2.

Джеймс Маккумиски - автор на книгата „Най-новият заговор: Биомедицинска парадигма“ - ни казва, че Националната лаборатория за вируси в Ирландия е поискала информация за нея от Университета в Дъблин и последният отговори, че „няма записи, които биха могли да дадат отговор на тяхното искане ” . Директорът на правните служби на лабораторията настоя за искането му до университета и университетът отговори по следния начин: „Позицията на университета е, че материалът за академичен дебат не може да бъде предмет на Закона за свобода на информацията“. От искането на NVR следва, че те не са култивирали SARS-CoV-2 или са го пречистили. Те признават само, че „са открили РНК на SARS-CoV-2 в диагностични проби .“

На 22 юни група експерти изпрати консултация с подобни условия до британския премиер Борис Джонсън . Писмото е подписано от д-р Кевин Корбет, Пиърс Корбин - професор в Имперския колеж в Лондон -, инженер и независим изследовател - с когото интервюирахме в списанието по това време - Дейвид Кроу , д-р Андрю Кауфман , Единбургския професор по биология Роджър Уотсън и биологът и химик Дейвид Расник - и до днес все още не са получили отговор!

Друго подобно искане - в случая до Националния изследователски съвет на Канада - получи следния отговор: „Не успяхме да извършим цялостно търсене на записите на NRC, така че съжаляваме да ви информираме, че не са идентифицирани записи, които отговарят по ваше искане. "

Ще добавим, че двама журналисти изпращат подобни искания - съгласно Закона за свобода на информацията - до различни институции в Канада, Нова Зеландия, Австралия, Германия, Обединеното кралство и САЩ, а към 5 септември дванадесет институции са отговорили , всички показват едно и също нещо: че нямат протокол за работа, описващ изолирането на  вируса, който трябва да причини Covid-19. Подробностите и отговорите могат да се видят на

https://www.fluoridefreepeel.ca/uk-dept-of-health-and-social-care-has-no-record-of- covid-19-virus-isolation /

ТЪРСИ ПРОИЗХОДА НА ЛЪЖНИЯ ГЕНОМ

Въпросът, който си зададохме тогава беше: ако публикуваните последователности не принадлежат - както се твърди - на нови вируси, откъде идват? И за да се опитаме да отговорим на този въпрос, решихме да извършим търсене с компютърна програма, наречена Basic Local Alignment Search Tool (BLAST) , инструмент за търсене на подравняване на последователности, който ни позволява да сравним дадена последователност с всички последователности, съхранявани в Националните институти на здравето на Съединените щати (то е публично и може да се направи справка на https://blast.ncbi.nlm.nih.gov/Blast.cgi . Обясняваме стъпка по стъпка какво направихме, за да могат нашите читатели да повторят търсенето на и проверете резултатите.

Първо събрахме всички инициатори на PCR, описани в протоколите, хоствани на уебсайта на СЗО по това време, които бяха тези:

  • Китайски CDC протокол: използва ORF1ab и N гени като цел.
  • Протокол на Пастьорския институт (Франция): използва два фрагмента от RdRP (за който се предполага, че е специфичен за SARS.CoV-2).
  • САЩ CDC протокол: използва три фрагменти от N ген.
  • Протокол на Националния институт по инфекциозни болести в Япония: той е единственият, който има за цел S гена заедно с други гени, за които се предполага, че са споделени с други коронавируси.
  • Charite Protocol ( Германия ): използва гените E, N и RdRP.
  • Хонконгски университетски протокол: използва ORF1b-nsp14 и N ген.
  • Протокол на Националния здравен институт в Тайланд: използва N гена.

След това въведохме последователността на праймерите - тази, която показва началото на последователността, която трябва да бъде открита (напред), и тази, която показва окончателната (обратна) - в BLAST , за да може да ги търси в две бази данни: колекция от геноми на микроби и тази, съответстваща на човешкия геном.

ПОСЛЕДОВАТЕЛСТВАТА НА ТАК НАРЕЧЕНИТЕ SARS-COV-2 СА НАМЕРЕНИ И ПРИ ХОРА И В БРОЙ МИКРОБИ!

Нека разгледаме подробно процедурата, като вземем за пример инициаторите на френския протокол. Веднъж попаднали на уебсайта на BLAST , ние избрахме Microbes за търсене в микробните бази данни за генома и се преместихме на следващата страница. След това се появи форма, в която въведохме последователността на препращащия инициатор на френския протокол - това е ATGAGCTTAGTCCTGTG -, избрахме опцията Силно подобни последователности и натиснахме клавиша BLAST . Само няколко секунди по-късно се появиха резултатите - направихме екранна снимка (изображение 1) - и ни бяха показани 100 последователности на микроби - особено бактерии и археи - със съвпадение между 77% и 100% с процент на идентичност 100%.

След това се върнахме на началната страница и този втори път, когато избрахме Human за търсене на човешкия геном, повторихме същата операция и след няколко секунди се появи резултатът, който отново заснехме на екрана (изображение 2). И се оказва, че въведената последователност съвпада с 74 последователности на човешкия геном , със съвпадение между 66% и 100% и процент на идентичност от 100%.

И това показва, че последователността на този първоначален PCR праймер, който се предполага, че е специфичен за SARS-CoV-2, всъщност съответства на 74 фрагмента от човешкия геном и сто микробни фрагмента също!

След това решихме да повторим операцията, но с крайния или обратния грунд - който е CTCCCTTTGTGTGTGT - и резултатите бяха подобни.

Тъй като това бяха много кратки последователности - около двадесет генетични букви или нуклеотиди - решихме да опитаме отново, но с целевата последователност, дефинирана от тези два праймера, т.е. последователността на предполагаемия геном на SARS-CoV-2, която е между първоначалния праймер и финален грунд . Очевидно за това ни беше необходима последователността, за която официално се твърди, че е „геном на SARS-CoV-2“ и въпреки че хиляди лаборатории твърдят, че са я изолирали и секвенирали - невярна претенция, както обяснихме в предишни доклади - решихме да отидете на уебсайта на Националния център за биотехнологична информация : https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? отчет = genbank & до = 29903. Веднъж там, ние открихме „целевата последователност“, фрагмент от 108 нуклеотида, разположен между позиции 12 690 и 12 797 от „генома“, която е тази:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG .

С това повторихме описаните по-горе стъпки и резултатите отново бяха изненадващи, тъй като отново се появиха сто микробни последователности с процент на съвпадение от 100% и четири последователности от човешкия геном с процент на идентичност между 83% и 95%. Следователно съвпаденията бяха по-ниски, но важното е, че продължаваме да намираме фрагменти от предполагаемата „целева последователност“ на SARS-CoV-2 както в микробите, така и в нашия собствен геном.

Наистина учудени, направихме още една стъпка и тествахме с гена, считан по това време за най-специфичния за SARS-CoV-2, гена Е, който трябва да генерира обвиващите протеини и се намира между позиции 26, 245 и 26, 472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA .

Повторихме с него вече описаните стъпки и резултатът беше още по-изненадващ, защото въпреки дължината му се появиха още стотина микробни секвенции с процент идентичност 100% и 10 последователности на човешкия геном с процент идентичност между 80% и 100% . И подобни резултати бяха получени с произволно избран фрагмент и с N гена, който според тях съответства на протеините на SARS-CoV-2 нуклеокапсида.

Най-накрая решихме да тестваме с гена S, за който се твърди, че генерира структурни протеини с "шипове", които са ключови за влизане в клетката и впоследствие се счита за най-специфичния ген на SARS-CoV-2. Тъй като това е ген, чиято последователност е много по-дълга - 3821 нуклеотида между позиции 21 563 и 25 384 - ние тествахме с два фрагмента, избрани произволно в рамките на този ген, а първият - TTGGCAAAATTCAAGACTCACTTTC - доведе до още стотина микробни последователности и 93 последователности на човешкия геном и вторият - CTTGCTGCTACTAAATGCAGAGTGT - сто микробни последователности и 90 от човешкия геном.

Накрая решихме да тестваме с инициаторите на Японския протокол, единственият, който включва целеви последователности на гена S и, както читателят вече се досеща, резултатите отново бяха подобни: сто микроби последователности и 93 последователности на човешкия геном с процент на идентичност между 94,12% и 100%!

ЗАКЛЮЧЕНИЯ

Последицата от всичко, което току-що обяснихме, е ясна и непосредствена: НЯМА ВАЛИДЕН ТЕСТ ЗА ОТКРИВАНЕ НА ТОРС-COV-2 , нито тестове за антитела или антиген, нито RT-PCR. И ние включихме тези, базирани на предполагаемия ген, който кодира протеина S1 или spike. И това означава това

ВСИЧКИ БРОЯ НА „СЛУЧАИ“, „ЗАРАЗЕНИ“, „БОЛНИ“, „Безсимптомни“ ИЛИ „  МЪРТИ ПРИ COVID-19 “ ЛИПСВАТ НАУЧНА ОСНОВА И ВСИЧКИ „ПОЛОЖИТЕЛНИ“ СА ФАЛШИВНИ ПОЛОЖИТЕЛСТВА,  нещо, което трябва незабавно да бъде съобщено на засегнатите а отговорните трябва да носят отговорност.

В заключение добавяме, че дори самата СЗО не вярва наистина в тези тестове. Просто прочетете документа, публикуван миналия 11 септември като лабораторно ръководство за SARS-CoV-2, озаглавено Диагностични тестове за SARS-CoV-2 - той е достъпен на https://apps.who.int/iris/rest/bitstreams/1302661/ извличане - и буквално се казва на страница 5: „Винаги, когато е възможно, предполагаема активна инфекция трябва да се тества с тест за амплификация на нуклеинова киселина (NAAT) като RT-PCR. Тестовете NAAT трябва да са насочени към генома на SARS-CoV-2, но тъй като не е известна глобална циркулация на SARS-CoV-1, последователност на Sarbecovirus (предполага се, че включва най-малко пет човешки и животински коронавируса, включително SARS-CoV-1 и SARS-Cov- 2)също е разумна цел ” . Тоест, СЗО се съгласява да  използва неспецифични последователности за откриване на SARS-CoV-2.

Това не е всичко, защото в наръчника по-късно се казва: „Оптималната диагноза се състои от тест NAAT с поне две независими от генома цели на SARS-CoV-2; обаче в области, където предаването е широко разпространено, може да се използва прост едноцелеви алгоритъм. "

В наръчника на СЗО се казва: „Един или повече отрицателни резултати не изключват непременно инфекцията с SARS-CoV-2. Има редица фактори, които могат да доведат до отрицателен резултат при заразено лице, включително лошо качество на пробата, късно вземане на пробата, неадекватно боравене или технически причини, присъщи на теста, като мутация на вируса или инхибиране на PCR . "

Какво чакат съдиите, за да действат по собствена инициатива?

Исус Гарсия Бланка

Забележка: авторът публично благодари на Хуан Педро Апарисио Алкараз за неговата търпелива и щателна  съвместна работа в търсенето на научни статии и за досадната му работа с BLAST.

ТОЗИ ДОКЛАД СЕ ПОЯВЯВА (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)

  •  Тиф и евреите
  • Екстремна сладкарница: Рождество „Черните животи имат значение“ в църквата 



Гласувай:
3
0



Спечели и ти от своя блог!
1. radostinalassa - Излиза, че тестовете...
19.12.2020 12:23
откриват микробни фрагменти. Сигурно има и гъбички.
цитирай
2. zahariada - Да
19.12.2020 12:56
Каквото си искат, но не и PCR.
цитирай
3. radostinalassa - Така е
19.12.2020 13:27
Хората трябва да разберат, че трябва да засилват имунитета си. Но това не става безплатно. Излиза, че те умират от бедност.
цитирай
4. apostapostoloff - Не го откриват само при пияндета като теб.
19.12.2020 13:57
И при изкукали дъртаци като Гадостина.
цитирай
5. ka4ak - 3. zax - Нии сме тъпи бели мишки....
19.12.2020 14:27


.... ГАДЮХА СЪМ СИ,ПЪК И ДРАКА!!!КОЕ НЕ РАЗБИРАТЕ?нещо КОЕТО НЕ ПОЗНАВАМЕ!НЕ СЪМ ДОКТОР,НО ВИЖТЕ ИЗХОДА 25 март · ЕВРИКА,като раздавал земите на народите,пак сме се били покрили и ни дал от НЕГОВАТА ЗЕМЯ,та да я запазим,КАРАНТИНА ДО ДУПКАimage ВЛИЗАЩИ трябва от самолета или границата със слец част,директно в хотел,без излизане от стаята 14 дни.....

.....СЛЕД ПОСТОВЕТЕ КОИТО СЪМ КОПИРАЛ ПО ГОРЕ/23 МАЙ-28 ЮНИ/,А И ПРЕДИ ГОДИНИ,ЩЕ ВИДИШ,ЧЕ СЕ ВЪРНАХ,ЗАРАДИ САБОТИРАНЕТО НА БЪЛГАРИЯ????А ИНАЧЕ ПРЕДЛОЖЕНИЕТО МИ ОТ ФЕЙСА-25 МАРТ,КОЕТО ПРИЕХА В АВСТРАЛИЯ,ЯВНО ДАВА РЕЗУЛТАТ,СЛЕД КАТО НА ОТКРИТОТО ПО ТЕНИС И ГРИШО И НОЛЕ,ЩЕ МИНАТ ПРЕЗ 14 ДНИ КАРАНТИНА,НО ЩЕ ИГРАЯТ,ПРЕД ПЪЛНИ ТРИБУНИ......


БЪДЕТЕ ЗДРАВИ И СВОБОДНИ!!!




цитирай
6. radostinalassa - Простите хора са си прости, факт.
19.12.2020 14:42
В США са направили статистика, че много повече негри умират от Ковид. Или от бедност, или заради признаците си. Тук не се прави статистика, но трябва да правим разлика и да ваксинираме всички Простоли. Те по приличат на афроамериканци.
цитирай
Търсене

За този блог
Автор: zahariada
Категория: Политика
Прочетен: 30181547
Постинги: 17759
Коментари: 20103
Гласове: 26983
Архив
Календар
«  Април, 2021  
ПВСЧПСН
1234
567891011
12131415161718
19202122232425
2627282930